Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13140G9
Clone ID IST13140G9
Vector VICTR74
Project tigm

Sequence tag IST13140G9BBF1
Sequence
CTGGAATATACNANTGNGTTNCTTCCTGNNNANATTTTTTTAAATCAATATTTATTTTGTTTTTCTCCTCTTTGANACAT
TTCCCGGTNTTCTCTCCTCTCAGCCGTCTCTTCCACCGGCCACATCTTCTGGATTCACCTGATGCCTCTGGCCCAGGCCC
TGCCCCATCTCACATGGTGGACTGGGCAACATGAGTCTCCAAATAGGCGCTTGTACACTTGTCTGTGCACCTCTTTACTG
CTACCCTGTAAACGTCCCTGCCTCACGTCTGTCTTCCTTTTCTCCTCAGGTTATAATGAGAACTACACCGAACCAGGTGG
GTCAGTGGGGCCTCATAGCAGGGAAAGTTTCAAATCTG
Sequence Type genomic DNA
Unitrap ID UNI27751

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110738281..110738637 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047257 (BC107230) NM_153172 Inactive testis serine protease 5 Precursor (Trypsin-like protease p98) [Source:UniProtKB/Swiss-Prot;Acc:Q8K4I7]

 
Come back to gene ENSMUSG00000047257


For any suggestions or comments, please send an email to unitrap@crg.es