Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0247
Clone ID AC0247
Vector pGT0lxr
Project sanger

Sequence tag AC0247
Sequence
TGGTCAGGAATTCGCTCTGGTGAGTTTCCTAAGGCGGCAGAAACTTCAGCCTCTTCACGGTAGTAAAAGTTGGTTTCCCC
TCCCCCGCTGCCGCCCAGGCCTGCGGCATTCCTTCCCTCCCGCCTCTCTGGATCGGGGCGGGCGGGGGAGGAGGGAGCCA
GAGCGCCTGTGCAGGGAGGCTGCTTTCCATCCGGGTACTTGTCGGTTCGGTGCAGCAGGTCGGTAGGCGGGAAATGGCGA
CTGGCTGAAGGAGCTGGTTCTGTTGCTGCTGAGGGATAAGCGGGAAAGACACCACCTATTGCGCAGTCGGGACCATCGCC
GGAGCCCGAAGACACTTTTCTGTCGTCACAGTGAAGGTTTACATGTGGCACCCGTAAAAGATGAAGCTGAGAACACGGAA
GGCTTCTCAGCAGTCCAGTCCAATCCAGACACAGCGCACTGCCAGAGCAAAGAGGAAATACTCGGAGGTTGATGATAGCT
TGCCTTCAGGAGGAGAAAAACCATCAAAGAATGAAACCGGCTTATTGTCTTCAATTAAAAAGTTCATTAAAGGAAGCACA
CCCAAG
Sequence Type mRNA
Unitrap ID UNI1125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121781998..121795015 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033411 (Ctdspl2) NM_212450 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Source:MGI (curated);Acc:Ctdspl2-001]

 
Come back to gene ENSMUSG00000033411


For any suggestions or comments, please send an email to unitrap@crg.es