Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11595G5
Clone ID IST11595G5
Vector VICTR76
Project tigm

Sequence tag IST11595G5HMR1
Sequence
GTGGTTGCTGGGACTTGAACTCAGGACCTCTGGANNAN
Sequence Type genomic DNA
Unitrap ID UNI6862 UNI8224 UNI9399 UNI10109 UNI13375 UNI33426 UNI34479 UNI34480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10405820..10405853 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 84805905..84805938 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28461357..28461390 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007570 (Fance) Fanconi anemia, complementation group E Gene [Source:MGI (curated);Acc:Fance-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14483054..14483087 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34172858..34172891 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022257 (Laptm4b) NM_033521 lysosomal-associated protein transmembrane 4B Gene [Source:MGI Symbol;Acc:MGI:1890494]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19071125..19071158 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021314 (Amph) NM_175007 amphiphysin Gene [Source:MGI Symbol;Acc:MGI:103574]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3609183..3609216 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071454 (Dtnb) NM_007886 dystrobrevin, beta Gene [Source:MGI Symbol;Acc:MGI:1203728]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 35206254..35206287 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056427 (Slit3) NM_011412 slit homolog 3 (Drosophila) Gene [Source:MGI (curated);Acc:Slit3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14796525..14796558 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27496902..27496935 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24921881..24921914 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23192360..23192393 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 30001771..30001804 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058440 (Nrf1) NM_010938 nuclear respiratory factor 1 Gene [Source:MGI (curated);Acc:Nrf1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3212947..3212980 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 15392597..15392630 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46415560..46415593 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19328855..19328888 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 35991123..35991156 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71063149..71063182 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027012 (Dync1i2) NM_010064 dynein cytoplasmic 1 intermediate chain 2 Gene [Source:MGI (curated);Acc:Dync1i2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 88067564..88067597 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062590 (Armc9) NM_027507 armadillo repeat containing 9 Gene [Source:MGI Symbol;Acc:MGI:1926045]


Sequence tag IST11595G5HMF1
Sequence
CCACATGGTGGCTCACAGCATCTGTGATGGGATCCGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3212913..3212950 38
NO GENE  


Sequence tag IST11595G5BBF1
Sequence
CCACATGGNGGCTCACAGCATCTGTGATGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000062590


For any suggestions or comments, please send an email to unitrap@crg.es