Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14501C1
Clone ID IST14501C1
Vector VICTR74
Project tigm

Sequence tag IST14501C1HMF1
Sequence
GGCTGACCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGTGCTACCATGCCCGGCC
ATATCCACTTTTTTTTTTTAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 77644065..77644165 101
NO GENE  


Sequence tag IST14501C1HMR1
Sequence
AGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCNATACAGAGAAACCCTGTCTCGAAAAACCA
Sequence Type genomic DNA
Unitrap ID UNI22269 UNI31185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4077458..4077525 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27388084..27388151 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4625811..4625878 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 9107074..9107141 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3483543..3483610 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12729506..12729573 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 15888326..15888393 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3447898..3447965 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5198525..5198592 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8619135..8619202 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18232415..18232482 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039835 (Nhsl1) NM_173390 NHS-like 1 Gene [Source:MGI Symbol;Acc:MGI:106390]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10969704..10969771 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5634787..5634854 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3292608..3292675 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068566 (Myadm) NP_001087233 myeloid-associated differentiation marker Gene [Source:MGI Symbol;Acc:MGI:1355332]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 18122384..18122451 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 6128782..6128849 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8566400..8566467 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7337543..7337610 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3198506..3198573 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10191796..10191863 66
NO GENE  

 
Come back to gene ENSMUSG00000068566


For any suggestions or comments, please send an email to unitrap@crg.es