Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14398A5
Clone ID IST14398A5
Vector VICTR74
Project tigm

Sequence tag IST14398A5BBF1
Sequence
GTAACTATTACTCAGCTACTCAATACAACTCTTTTATAGAGATCCATTTAGGGCCACAGAGGTCCTGGCACCCAGAGCTG
GCTTCATGAGCATGACAGCTATGCCGGTCGCTGGGCCTCTTGTTCAGAGGACCTACGCATGGCTTGAGAGCTGCTATTGT
GAACTCTCAGAAATTCCAGTAATTTACAAAGAAGGCATCCCACTTCTCTCTCTCTCTCTCTCTCNCTCNCNCNCTCNCNC
N
Sequence Type genomic DNA
Unitrap ID UNI22700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91720932..91721167 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058240 (Cryzl1) NM_133679 crystallin, zeta (quinone reductase)-like 1 Gene [Source:MGI (curated);Acc:Cryzl1-003]


Sequence tag IST14398A5HMR1
Sequence
GTTACTGCTCTCTANGATGANAAAATCAAATGCANAAACTAACCACAGGCACGCCTTTAAGACATGGACTTAAAGTATGT
AGTATGTATGTCAAGACGGTGAAAACCATGGCTAACAGCAGCCCTTTATCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 91721163..91721294 126
 
EST/CDNA Est Name
  CB232212.1 - AA061855.1

 
Come back to gene CB232212.1 - AA061855.1


For any suggestions or comments, please send an email to unitrap@crg.es