Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S17-3E1
Clone ID FHCRC-GT-S17-3E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S17-3E1
Sequence
TGAACCTTCTGGTGANCATAGTTGACACCAACCCGATTTGGTGGGGAAAGCAAGCATTAAAGGAATCTCAGTTTACTTTA
TCCAAATGCATGGATGCAGTGATGGTGCTGGCGAATTCTCACCTGTTCATGAACCGCTCCAACCAGCTGGNTGTCATCGC
CAGTCACATTCAGGAAAGCCGGCTCTTATACCCGGGGAAGAACGGTGGACTTGGAGACTTCTTCGGAGACCCTGGCAATG
CGCTCCCCGACTGTAACCCCTCTGGGAGTAAAGATGGGAAATACGAGCTGTTGACNGCCGCAAACGAGGTGATCGCTGAG
GAGATCAAGGATCTGATGACCAAGAGTGACATCAAGGGCCAGCATACGGAGACACTACTGGCAGGATCCCCTGGCCAAAG
NTCTGTGCTACATTCACAGAGTGAACAAGGNAGTTAAAGATAATCAGGAGATGAA
Sequence Type genomic DNA
Unitrap ID UNI11900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125032466..125034313 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029387 (Gtf2h3) NM_181410 general transcription factor IIH, polypeptide 3 Gene [Source:MGI (curated);Acc:Gtf2h3-001]

 
Come back to gene ENSMUSG00000029387


For any suggestions or comments, please send an email to unitrap@crg.es