Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14670H7
Clone ID IST14670H7
Vector VICTR74
Project tigm

Sequence tag IST14670H7HMF1
Sequence
GGATTAAAGGCACTTTTAATAGCTGTAAATGATAGAAAAGCTATCCTTTTTCATGGGGCAAGGGTGGAAAACAGAAAGAT
CCTTCAAAAGAAACTAAAAACAATGAATGGCGAGCATTAAAATTGCCTCATGTTTATTGTCACTAGCTCAGACTGTTCAA
TAATCCACTGGCGAATGGACTTGCATAACCACCCTTAGTAATAATGGGAGGGAACCCCTGACATGGACGTCCTCAGGGAG
GATTTACCATACTGGCTAAGCTGCATCAGAAGTCCTCTGAGATCACTCCTAACTCTTGCACTAACAACTACCTTATCTTC
AAGAAGAGGCTAAACAGTGCAGGGCGTGGTGGTGCATGCCTTCAATCCCAGCACTTGGGAGGCAGANGCAGGCGGATTTC
TGAGATTTCTGAGTTCAAGGCCNGCCTGGTCTACAAAGTGAGTTCCNNGACAGCCNAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138013271..138013728 448
 
EST/CDNA Est Name
  CF616345.1 - BF466147.1 - BM939919.1


Sequence tag IST14670H7HMR1
Sequence
ATCCTAGCACGTGGGAGGCAGAGGCAGGCTATCTAGTGAGACTGTCTAGGAAAGGAGTGTGGGGAGCTCTAATCTAGTGT
ATTCCAATTTAAAGCATAAGCCTCATATAATTTAGAACTCCTTTGCCCTCTTACCCAGCATC
Sequence Type genomic DNA
Unitrap ID UNI31689

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138013725..138013866 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es