Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14827G9
Clone ID IST14827G9
Vector VICTR76
Project tigm

Sequence tag IST14827G9HMR1
Sequence
AGGGAAGCTTTTCCTGTCCCTACTTCCCATGGGATTGGAGCTTCAAGCAGGCCATGCCCTCCTAAAGACATGAGGCAAGG
CTGAAAGGGTGGCTCCCTGGGGCTCTTCTAGGGCTGTACCATTTCCTAGTCCTCAGGGGACATGCATCACAGGGCATGTG
TAGCCATCCCACCACACCCTGCTTGGCCTCAGAGGCTTANTCCAAGTGACAGTGGGACAAGGAGAGACAGGAGCTGAGAC
ACTTCCAAACCTTTCTATGCACATGTATGTCACTTGGTGCACAACCNCGATCAAGTCNGGACAGGTGGATCCNCAGCCNA
GCTCCTGTTCCCCCATGCCTGCACTACCAGCACAGACACACGTTTCAAGTAACTNCAACTTGCAGCANTANTTGTCACNA
GCTTACAANANCNTACCCGTTTGANGAANGTTACAGTANATCAGTTATAAACGAGTGAANGTNACATANGCNGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14827G9HMF1
Sequence
CCCTGGGTAGGAGCTTCCTTCCCTTCCTTGTTGCTTTTCTCTTACCTTTGAGCCCAGGAGTGAGAGGCCAAGTCGGCGAG
ATGGAAAGAGCCGTTCACAGGTCTAGAGTTTTGCGTAAGCGAGCGAGAAAGCGCCCTCATTTGTCCAAGTCTTGTCTGCA
GTTGGGGTGTTAGGAACATCTCCACTGGCGGGGACTAGGGTTCGCTTTCCACTCTGATGAGAGAATGGCATGCCCACGTG
TGGAGGGGATGAGCTCTGANTNANNCATTTN
Sequence Type genomic DNA
Unitrap ID UNI30424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97257894..97258163 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038485 (Socs7) NM_138657 suppressor of cytokine signaling 4 Gene [Source:MGI (curated);Acc:Socs7-001]

 
Come back to gene ENSMUSG00000038485


For any suggestions or comments, please send an email to unitrap@crg.es