Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S17-12D1
Clone ID FHCRC-GT-S17-12D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S17-12D1
Sequence
ATTTTACCAGGGGATTCCATGACCACATGCCTTTCTCCTTTAGTGCATGACTTGATTTGTAACCTTGGGTTTGAACTCAA
AGAAATTTGTGATATCAATAGCATTGTAACTCAAAATGGTGAAGTACGATGGAAAGCAATTACTGACCGTGTGAGATATG
AAGAATTAGGTTTGTATTCTCTTTGTACATCAAGCTTCCGTTAGTACTGTAACATTAAAAATTTGTTGTGTGGTTAAACC
TTCAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116465..15116708 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es