Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14287F2
Clone ID IST14287F2
Vector VICTR74
Project tigm

Sequence tag IST14287F2HMF1
Sequence
CTGGTCTTGTCTGCCTACAGCCGGCACAGAAAAACACAGTCAGCAGAGATCAGCACTCCCAGAACTTTTTGTCTATCTAT
GATTTCTAGCTGGGCAAAGGAAAAGAAGTCCAGCTGTTTAGTAGCAAGAGGCTGCTATCATTGTATCCTTTACTGTATTA
ATTAGAAATGATGGCACAGAGATGTAGCCTCTTGTAAAGTCCCACAGCACACAGGGGGTTGAATTAGAACTATAAGCAGG
AAGCTGGCCNCCCCGGCCAGANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5254990..5255250 259
 
EST/CDNA Est Name
  BY087560.1 - BY083082.1 - BY036655.1 - BY101698.1 - BY092154.1 - BY082880.1 - BY067694.1 - AW229902.1 - AI786826.1 - BB646936.1


Sequence tag IST14287F2HMR1
Sequence
GTAATTGCAGGTTTCTTGAGTGTAGGGCCCTTGGCCCTCCGGGAGTTCTTAGGACATTTTTGGCTGCGAGCTTCCCAGCA
GGCCAAGGTATTGGATTTCTTCAGCCCTTGGCAGCAGCCCTTANAAACATACAGCTCTTGTGCAGGTCTTGGAAGTGCGG
ATTCATTANCTCTNNNCCN
Sequence Type genomic DNA
Unitrap ID UNI19233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5254818..5254990 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022544 (5730409G15Rik) NM_027446 RIKEN cDNA 5730409G15 gene Gene [Source:MGI Symbol;Acc:MGI:1917761]


Sequence tag IST14287F2BBF1
Sequence
CTGGTCTTGTCTGCCTACAGCCGGCACAGAAAAACACAGTCAGCAGAGATCAGCACTCCCAGAACTTTTTGTCTATCTAT
GATTTCTAGCTGGGCAAAGGAAAAGAAGTCCAGCTGTTTAGTAGCAAGAGGCTGCTATCATTGTATCCTTTACTGTATTA
ATTAGAAATGATGGCACAGAGATGTAGCCTCTTGTAAAGTCCCACAGCACACAGGGGGTTGAATTAGAACTATAAGCAGG
AAGCTGGCCTCCCCGGCCAGAGCTCTGATTCTTTCCTTCTTAAACTCCTGGTCAAATGGAGTGACCACAGACGCCAGTGC
TGTGCACTGTGGGTGACCCTGAGCAAGTACTTAGCACAGCACATGAACTATTATTACNGTTGACATTGANTANNGACTTA
TATGTTATTCGGGTTNCNTTTTGCGTTNAGACNANANATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5254990..5255428 419
 
EST/CDNA Est Name
  CK622585.1 - CA976629.1 - CJ060208.1 - CF892269.1 - BB617754.1 - BX526277.1 - BG077337.2 - CJ174306.1 - CJ182671.1 - CJ168695.1 - BY087560.1 - CF170046.1 - CF170364.1 - BY083082.1 - BY036655.1 - BY101698.1 - BY092154.1 - BY082880.1 - BY067694.1 - AW229902

 
Come back to gene CK622585.1 - CA976629.1 - CJ060208.1 - CF892269.1 - BB617754.1 - BX526277.1 - BG077337.2 - CJ174306.1 - CJ182671.1 - CJ168695.1 - BY087560.1 - CF170046.1 - CF170364.1 - BY083082.1 - BY036655.1 - BY101698.1 - BY092154.1 - BY082880.1 - BY067694.1 - AW229902


For any suggestions or comments, please send an email to unitrap@crg.es