Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S17-11G2
Clone ID FHCRC-GT-S17-11G2
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S17-11G2
Sequence
CAACATGGCCAATGCCTTGGCCAGTGCCACGTGTGAGCGCTGCAAGGGAGGCTTTGCGCCTGCTGAGAAGATCGTGAACA
GTAATGGTGAGCTGTACCACGAACAGTGCTTCGTATGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTTTATGAG
TTTGAAGGAAGGAAGTACTGTGAGCATGATTTCCAAATGCTCTTTGCTCCCTGCTGCCACCAATGTGGTGAATTCATCAT
TGGCAGGGTTATCAAAGCCATGAACAACAGCTGGCATCCTGAGTGCTTCCGATGTGACCTCTGCCAGGAAGTGCTGGCAG
ACATAGGGTTTGTCAAGAATGCTGGCAGACACCTATGTCGCCCATGTCATAATCGTGAAAAAGCCAGAGGCCTTGGAAAA
TACATCTGCCAGAAATGCCATGCCATCATTGATGAACAGCCTCTGATCTTCAAGAACGACCCCTTACCATCCAGA
Sequence Type genomic DNA
Unitrap ID UNI14446

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 57861769..57872926 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019920 (Lims1) NM_026148 LIM and senescent cell antigen-like domains 1 Gene [Source:MGI (curated);Acc:Lims1-001]

 
Come back to gene ENSMUSG00000019920


For any suggestions or comments, please send an email to unitrap@crg.es