Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13554G8
Clone ID IST13554G8
Vector VICTR74
Project tigm

Sequence tag IST13554G8HMF1
Sequence
TTAATGTTACTAAGTGAAGCTGCCATCCTGTATGTANAACATGGTAGAGTTAAGACAGCTGCAAGTGCATGCAGTTGTGG
GTACTTCTTAAAATGAAAATGGTTTTCAAATTTTTGGAGAGAAATCTGATTTTTAAAAAATATTTTCACTTCTTTAATGC
TATGTTACATATAGAATGATTTTCACAGATAATCACTTCAAAAGGCTTTTCATATTTGTTAGAAATAACAAACCATATGT
CATCTTGTANATGCCCTGATTTGGTAGGAACATGGCTCTTGGCCNGCC
Sequence Type genomic DNA
Unitrap ID UNI12869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8864627..8864913 281
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040269 (Mrps28) NM_025434 mitochondrial ribosomal protein S28 Gene [Source:MGI (curated);Acc:Mrps28-001]


Sequence tag IST13554G8BBF1
Sequence
TTAGCAGAGTTAGCNCTTGACTGTCTCACAACTCTTCTAGTATCTCTGCTTCTATCCACTCTCACAGACACAGCTAACTA
GTACACAAGTCTTGACAACTTCTAATAACCAAATGAGCCTTGCAGTATTCCTGCTAACTTTCACAATATANCATATTTGG
TCAAAATCAAACACTTCCTTTAAAGCTTCCTTCATTAAACTANNNAAGAGAATTNGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70324592..70324810 203
 
EST/CDNA Est Name
  CA883725.1

 
Come back to gene CA883725.1


For any suggestions or comments, please send an email to unitrap@crg.es