Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S17-10A2
Clone ID FHCRC-GT-S17-10A2
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S17-10A2
Sequence
TTATGAATGCAGGAATGAGAAAATACTTTCTACATGATTGGCTTTAAATGTCCGGGAAAACTAATTTCAGTAGCGTAGTT
TGATAGGTTAAATGAGATAGCATTTTTATATCAGAGACACCAGAATGTTGGTGGTCAACTACCTGTGCAATATTTATGTC
TTGAAAACCAGATCTGAGTATGCATTGAACAGTGGGGATATTATAAACAGAAGCGCCTCTCTGAAGAACCCGGTTTCCGG
TGTTGAGTGATAGACTGGTTTGAGCGAGTACTGTTTTGTGGTGACATCTTAGGTGTTTCCTTTCTCCCAGGCTGCTGCTC
TGTGGTATTTCCAGTCTCAGACTTGTGTTGTGGAGTCATGGTGTTAGTGTTCTGCCTTTTTATGTTCTAAGACTACTTGT
TAGAGGACGGAAGATTTGCTACAGTGGTCTAGAGTTAAAATGTGCTCTTTAGTTGCCCAGCACAAGAACGTACCACTCAC
CTTTTGTATTCATAAGCTAATATGTTAGAGTTCTATGTAGTTTTCTCTTGTGCACCTGCATCAGAAAACCATAGGACAAC
AAGGTGGCTAGGCAGTTATCACCCCTCTGCTGCCGTATTCATCACCCAGGCTCTCTTACAAGTTCCTTGTTAATGC
Sequence Type genomic DNA
Unitrap ID UNI10418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 138035695..138056332 607
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040268 (Plekha1) NM_133942 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 Gene [Source:MGI (curated);Acc:Plekha1-002]

 
Come back to gene ENSMUSG00000040268


For any suggestions or comments, please send an email to unitrap@crg.es