Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14280A8
Clone ID IST14280A8
Vector VICTR74
Project tigm

Sequence tag IST14280A8HMR1
Sequence
GATCTGACTGAGCTTGCCAGTGCTGTCAGTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI31514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20481505..20481539 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]


Sequence tag IST14280A8HMF1
Sequence
AGATCTTTATTTATGTGTATGTCCTAGGGGAGAAAGGAGTTTAGAAGTTGGTTAGGTTTGTTGTTTAAATCNNCATTTTG
CTTATAGGTTCTCCATGANCAGTCTGTAGGGATACACTTTAATGGCTTGGCTTTCTTGTGCNNACATGTNTTATCTTTGT
AAGAATGTGAATANCANANTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20481334..20481509 162
NO GENE  

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es