Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14454C2
Clone ID IST14454C2
Vector VICTR74
Project tigm

Sequence tag IST14454C2HMR1
Sequence
CTTGATGTCGCGATTATCGTTTTCCTTAGTTCGAGGAGCCCTCCCAGCATTCTCGAGTAGGCACCACTGTCGGAGCTTTA
CAGCCATAGTTCGGAGAGGTAAAGTCACTTGTCAGTGTTACATCGCTGCAGAGTGGCAGAGCCAACATTGCTTTCAAACC
TGTCTTCCTGTCTTGTGTTTGAACCCCGGGTTGCTCCCATCGTGTCTTGAAAGGANTACTCTGCAACAGAAAACAGTAAC
GTGTCTGGCGACTGTCATCTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI34485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148415131..148415394 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038611 (Phrf1) NP_001074587 PHD and ring finger domains 1 Gene [Source:MGI Symbol;Acc:MGI:2141847]


Sequence tag IST14454C2HMF1
Sequence
AAGCACAATTTGGGCAAGTTCAGATGGTGCTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148415097..148415133 37
NO GENE  

 
Come back to gene ENSMUSG00000038611


For any suggestions or comments, please send an email to unitrap@crg.es