Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S5-2H1
Clone ID FHCRC-GT-S5-2H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S5-2H1
Sequence
GTGGTGGTTGGAATGATAAATCATTTACCTACGATTTTGTGTTTGACCCCTCTACTGAACAGGAAGAGGTCTTTAATACA
GCAGTAGCTCCACTCATAAAAGGCGTGTTTAAAGGATACAATGCAACTGTCCTGGCCTATGGGCAGACTGGATCTGGAAA
AACGTATTCAATGGGAGGTGCATACACTGCAGAACAAGAACATGACTCAGCCATTGGGGTTATTCCCAGGGTAATACAAC
TGCTCTTCAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97822043..97829318 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034311 (Kif4) NM_008446 kinesin family member 4 Gene [Source:MGI (curated);Acc:Kif4-001]

 
Come back to gene ENSMUSG00000034311


For any suggestions or comments, please send an email to unitrap@crg.es