Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002D12
Clone ID IST15002D12
Vector VICTR78
Project tigm

Sequence tag IST15002D12HMF2
Sequence
CTTTGGGCTCTCTATCTACCAAGAAGAGCTTCCTCCACCACAGGCAATGCTCTGTCCAAGGAGGACACAGGAGCCCATGA
GCCAAAACAAAGCTTTCCTCACTGAGTCATCTCTGTCAGGTGTCTGGGCACTCANGNNNNGTTCCATGGGAAAAGGTGGC
CTCTAANCTCCNGCNNANATGCCNCTGTCCCCTCCTACCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15002D12HMR1
Sequence
AAGGAGTGTANCTTTGGGTGTGATTTCTCCTTCCTTCCTCTGCGTTCCGTACTGCCTTAACCCCCAGCCCATGGGATGGT
ACCACCCACATTCAAGGCAGGTCTTCCCTTCAGCTAATCCTATCTGTATGTATCTTCAAACACAGCCACAAATGGACCAC
AACAGCCCCTGGGTGGTTCTANATCTANGCAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153357..104153551 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST15002D12BBF1
Sequence
CCTCCGCTCTCCCCCCTGTCTATCCTGTCTCTGACNAATAACTACAGTGGCCAAGAGCTTGCTCATCTCTCTATGTCTTC
TGCGGTCCCTTTCTTTTTCTTTCTGCTCATCTTCTGCCCTACGGCGTTCTTTTTTTTTTTCCN
Sequence Type genomic DNA
Unitrap ID UNI31556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5908296..5908435 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057897 (Camk2b) NM_007595 calcium/calmodulin-dependent protein kinase II, beta Gene [Source:MGI (curated);Acc:Camk2b-009]

 
Come back to gene ENSMUSG00000057897


For any suggestions or comments, please send an email to unitrap@crg.es