Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S5-2A1
Clone ID FHCRC-GT-S5-2A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S5-2A1
Sequence
GCTCCTGTTCAGATCATNCACGGGGAGCAGGTCCCAGGTGCTCGCCCCATAGGCTTCCATCTAAGCCCCAGTTTTGGTAT
GTCTTTGGTGGTGGGACCCAGCTCACAATCCTAGGTCAGCCCAAGTCTGACCCCTTGGTCACTCTGTTCCTGCCTTCCTT
AAAGAATCTTCAGGCCAACAAGGCCACACTAGTGTGTTTGGTGAGCGAATTCTACCCAGGTACTTTGGTGGTGGACTGGA
AGGTAGATGGGGTCCCTGTCACTCAGGGTGTAGAGACAACCCAACCCTCCAAACAGACCAACAACAAATACATGGTCAGC
AGCTACCTGACACTGATATCTGACCAGTGGATGCCTCACAGTAGATACAGCTGCCGGGTCACTCATGAAGGAAACACTGT
GGAGAAGAGTGTGTCACCTGCTGAGTGTTCTTAGACCACAATCCTCCCTGAAGCCTCAGGGGCCTGGATCTGAAGTGCCA
GAAAAAGTTGTTTTTTGTTTTGTTTTTTGTTTTTTTTCCCATTAACCATCTCACTGTCTTTCCTGTGCCTAATACTCAAT
AAATATCTTACCACCAACAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI13377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16860764..16862637 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075370 (Igll1) immunoglobulin lambda-like polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:96529]

 
Come back to gene ENSMUSG00000075370


For any suggestions or comments, please send an email to unitrap@crg.es