Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11067H6
Clone ID IST11067H6
Vector VICTR76
Project tigm

Sequence tag IST11067H6BBF1
Sequence
TCTGTGAGTTTGAATTCTAGGCTAGCCAGGGCTACCCTGCCTCAAAAAACCATGGCCAACAAAAATCCAACCAACCAACC
AACCAACCAACCAGACAAAAAAGAATAAAGAAAAAATGTGCTGGAGAGATAGCTCAGTAGTTATGGGCATTTCTGTTTTC
CTAGAGGACCTGCATTCAGTTCTCAGTACCCACATCAAGTGGCTTACAATCACTGCTAACTCCAGTTCCAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95482599..95482837 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]


Sequence tag IST11067H6HMF1
Sequence
TCTGTGAGTTTGAATTCTAGGCTAGCCAGGGCTACCCTGCCTCAAAAAACCATGGA

Sequence Type genomic DNA
Unitrap ID UNI31759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95482783..95482837 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es