Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14500F10
Clone ID IST14500F10
Vector VICTR74
Project tigm

Sequence tag IST14500F10HMF2
Sequence
GAAGGATGTATTAAGAGCCTCTGTCAGGCACTTGTCATACCAACAAGACACTAACCAGCACAGCTGCTGTCCTGAGTGTC
CGGGAAAGGAGATGAAGTGTCGCTTGGGACTAGGACAGAACTCTCAACAGTGCCTGAGACTGCCCCAAACACAGTTTTAG
CAGTCTGTGCTATGAATTCCTGTGAACTGGCACTCTCAGCTCANATATTGTGAAATCAGGGTTACTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83293729..83293958 228
NO GENE  


Sequence tag IST14500F10HMR1
Sequence
CTTCCTGGACAGGGAGACACAGGGCGAGGGAAAC
Sequence Type genomic DNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83293955..83293988 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]


Sequence tag IST14500F10BBF1
Sequence
ATGGTATTTCCAAGAAGCGGGGGCCTGAAACAAGAAGGCCTAGCCTAAATATGGCTCCAGGGAAAGCAGACAGTAGAACT
GGAGGGTGACCTCAGAAGGAGGAGAAAACCTGGTGCCTGGAGGAAGCAGGGCAAGACCGGCTGAGGCCTGACATGAGGCC
TCTTGCTCAGAGCCAGAGGCAAGATCAAGTGACCTCTTAAGGATTCAAAACTCAGAGAGACAAAGCCCAGAACAGCCAGG
CCTGGGCATGCCTGCTGACCCTGGCTGGCTGGTGGTCTTGGAAACTGCCTCCTGTTCCGGTCCAGCCCCAGCTGGTGTAA
CCTGGGAGGANCTGTGACATTTCTCTTGGCCTCCCTTCTACAGCNNAGANCTAATAGGGAGGAGAGAANGATTAGAGATT
CCTGAATGTATCTGGTCCCTTTCCNCCATCTCATCTCTACTCCTGGGGTCTGCTGCANTTGGTATTTGGTTNNANNNNCC
CANTNNGGANCTANTCTGTCTGGNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132626186..132626688 467
 
EST/CDNA Est Name
  AW488152.1 - AI448834.1 - AW542359.2 - BG064022.2 - CO042352.1 - BU758034.1 - AW490315.1 - AU021060.1 - BG069894.2

 
Come back to gene AW488152.1 - AI448834.1 - AW542359.2 - BG064022.2 - CO042352.1 - BU758034.1 - AW490315.1 - AU021060.1 - BG069894.2


For any suggestions or comments, please send an email to unitrap@crg.es