Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S5-10H1
Clone ID FHCRC-GT-S5-10H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S5-10H1
Sequence
GAGGCCCAGCGGCCCCGGGCTGCATCAAGTGGAGGAGGAGGAGGCGGAGGAGGGTGGCACCATGGGCCCGGGCCGTGCCC
TCCATGCCCGGGGGATGAAGACACTGCTGCTGCTTCTGGCTTGCCTCTGTACTGTGTGGTGTGGAGGGCACTAAGTATCA
CTGAGGAGCAACAAGGAGAGACCTCTGCTGCCCCGTGAGCGAGCGGTGCTGGGTTTTGACCTGGGCAGTGGCCAGTGTGG
CTGGCGGTCATGACTGGTGGCTGTGTCTGGTCCGTTGAGTGTAGAGCTGAGAAGAGGCAGGATTTGGGGTTGAGGTGAGT
CATGGCCTCTTGCTGGAAAGGTGTGTTGGGGTGTGGGTGTCATCTCACCCTCGTCCCCACTCCTCCGGNCTGGAATGTGA
AGTGACTCCCCAGCCCCTTTGGCTGTGGCAGTGTATGGACTGGGCTGCCACTGTCTGGGCAGAGTAGGGTGCCATGACGA
GCATGGGTATGGAGGTTCTGCCAGCCAAGAAATAAAAGTTTACCTCA
Sequence Type genomic DNA
Unitrap ID UNI14623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27943685..27950628 424
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058709 (Egln2) NM_053208 EGL nine homolog 2 (C. elegans) Gene [Source:MGI (curated);Acc:Egln2-001]

 
Come back to gene ENSMUSG00000058709


For any suggestions or comments, please send an email to unitrap@crg.es