Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10115D6
Clone ID IST10115D6
Vector VICTR76
Project tigm

Sequence tag IST10115D6BBR1
Sequence
TGATCACCCTTAGTTTAAATAAATCTTTTGGAAGCTTTTGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168590356..168590399 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es