Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14620E1
Clone ID IST14620E1
Vector VICTR74
Project tigm

Sequence tag IST14620E1HMF1
Sequence
CTATGAGACCNACCTGGGCTGTCTCCCGAACACCGGGGAAAATCCTTAAAATAGGGTCCTTTGCTAAAAAAAAAACAACA
NCAACAAAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36052833..36052925 89
NO GENE  


Sequence tag IST14620E1BBF1
Sequence
CTATGAGACCNACCTGGGCTGTCTCCCGAACACCGGGGAAAATCCTTAAAATAGGGTCCTTTGCTAAAAAAAAAACANCA
NCANCAAAAAAAANCCNAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14620E1HMR1
Sequence
NNNNNNNGNNGNNNNNGNTGGTANNGATCNCTGGNNNNNNNNNNNTANNNCCCNNNNNNNNNNNTCCTACTCCACCTCGT
CACACGTCATTTCCCCATCANAGCATGCTTGAGATCATTCTGCTCTCTGGATTGANATTGCCCTTTANCCTCANGTACTC
ACCACCCTGGAGGTTCN
Sequence Type genomic DNA
Unitrap ID UNI15265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36052660..36052771 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024436 (Mrps18b) NM_025878 mitochondrial ribosomal protein S18B Gene [Source:MGI Symbol;Acc:MGI:1914223]

 
Come back to gene ENSMUSG00000024436


For any suggestions or comments, please send an email to unitrap@crg.es