Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14371D8
Clone ID IST14371D8
Vector VICTR74
Project tigm

Sequence tag IST14371D8HMR1
Sequence
TGATAAACATACACAGGACAGACCCCCAGGCAGGTCANGTNNNNTTNTTGANCTATNNNACTGTAGGTCTCTCACCCTGG
NGGATCCCTCTGGCAAGGCTGAGACCAGGTGAAAAGCCNGAGGGTACAGAGCGGGCTAGTCAGTGGGTGGCACAAGAAAA
CCACGAAGGCAGGGTCTCTGGGACCCGTTTCAAGCCGGTTCCAGCTGGGACTGCTCCAGGACATGGGCNNNNNANCGGCA
NCNNGTANTTGTGTAGTAGGGGTANACGCNNANNCGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14371D8BBF1
Sequence
TCACTTCCACAAAAGCAGCTTGAGAAAGAATAGGAAGTGGGCGGTGCCTGTATCCCTCATGCTTTTCTGGGCTGGGGAGA
AAGGGGGAGAGAGCAAGGTTATATTTCCACACTAATCTGAGCTACATAGTGTGTGTCCCCCAGAAGTTCCAGGTCTGTGC
CCCAATCCTCGTCTCCACATCTTCTAAATTACCCTGTTGTTCCCATCCCTGCCTTATCTAGTCTCTGTATTCCTACCTCC
CTCATTAGCAGGGGCAGGGATCAGCCACTGCTACCCTACCTTACTGGGGAAGGACCACACCTCTCCNNGGCANGGACCAC
TTGTGTCGAGGGTGAAAAAGAGAAACGTCANCATAAGACATCCTANCCCCAGTCGCCACTTNNCACTGAAAATGATGCCC
ACCCCAGAAGTNATTTATTTTTTATTNAAGTTGGTTTTGACATN
Sequence Type genomic DNA
Unitrap ID UNI34497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95480127..95480569 425
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es