Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S4-4G1
Clone ID FHCRC-GT-S4-4G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S4-4G1
Sequence
TTGCCAGGGTTTGGATCCCTGATCCTGAGGAAGTGTGGAAATCGGCAGAGTTGCTCAAGGATTATAAGCCTGGAGATAAA
GTGCTCCTGCTTCACCTCGAGGAAGGGAAGGATTTGGAATACCGTCTAGACCCAAAGACCGGTGAGCTCCCTCACTTACG
GAACCCTGACATACTTGTTGGAGAAAATGACCTCACAGCCCTCAGCTACCTTCACGAGCCCGCTGTGCTACATAATCTCC
GAGTTCGCTTCATCGATTCCAAACTTATTTATACGTATTGTGGAATAGTTCTGGTAGCTATAAATCCCTATGAGCAGCTG
CCTATTTATGGAGAAGATATTATTAATGCCTACAGTGGCCAGAACATGGGTGACATGGATCCTCACATCTTCGCAGTAGC
TGAAGAGGCTTACAAGCAAATGGCAAGGGATGAACGAAATCAGTCCATCATTGTAAGTGGATATTCGGGTCCGTGTGAAG
GGTGGTGGACATGTGGCCCAAATTTATGCCATCCGACAGTCCATCTCAAAGGCCCTGGTAGCTTATTACCAAAAATATGT
GGATGAAGCCTCCAAGAAGGAGATCAAAGATATCCTCATCCAATACGATCGGACCCTGCTTGTAGCTGACCCCCGTCGCT
GCGAATCCAAAAAGTTTGGAGGTCCTGGTGCCCGTGCCCGATACCAGAAATCCTACCGATAAGCCCATCTCAAGGATCGG
GGT
Sequence Type genomic DNA
Unitrap ID UNI14631

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 74963994..75606164 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034593 (Myo5a) NP_034994 myosin Va Gene [Source:MGI (curated);Acc:Myo5a-001]

 
Come back to gene ENSMUSG00000034593


For any suggestions or comments, please send an email to unitrap@crg.es