Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14721F5
Clone ID IST14721F5
Vector VICTR76
Project tigm

Sequence tag IST14721F5HMR1
Sequence
CCNTCAGCGAAGCTGATGTGGCCTTCCCGGCGTCCGTGGCGGGTGCGAGTGGTGCATGCTGGGAGGTGTGGCGGCATCCT
GGAGAGCGGCATCCCGGAGGCGCCAAAGTCTTTACCTACCTTCTGCTGACACACGAGTGTAACATGTGTTGGTTGTCACA
AGCCATGAGGCCGGCTGTGCACATANGCAGCTTTGGGGAACCANANNCAGGGCCCGAGGTGCATGGTGGGGCTTGTANTC
TCCACGAGGGAAAAAAAAATGGCTN
Sequence Type genomic DNA
Unitrap ID UNI26433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56904380..56904643 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007603 (Dus3l) NM_144858 dihydrouridine synthase 3-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147092]

 
Come back to gene ENSMUSG00000007603


For any suggestions or comments, please send an email to unitrap@crg.es