Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S4-2F1
Clone ID FHCRC-GT-S4-2F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S4-2F1
Sequence
ACGTCCAGGATGGCCGACAGTTTCTGAAGTATGTGGATCCCAGGCTGGGAGTCCCATTGCCAGAGAGGGACTACGGGGGC
AACTGCCTCATCTATGATGCTGACAACAAGACTGACCCTTTCCACAACATCTGGGACAAGCTGGATGGCTTTGTTCCTGC
ACACTTCATTGGCTGGTATCTGAAG
Sequence Type genomic DNA
Unitrap ID UNI14633

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148337552..148338141 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025495 (Ptdss2) NM_013782 phosphatidylserine synthase 2 Gene [Source:MGI Symbol;Acc:MGI:1351664]

 
Come back to gene ENSMUSG00000025495


For any suggestions or comments, please send an email to unitrap@crg.es