Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S4-2C1
Clone ID FHCRC-GT-S4-2C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S4-2C1
Sequence
TCTGCCTTTCTGGGAGAAGGAAAAGCCAACAATTTGAAGAACGAGATAAAAGAAGTCGAGGAGCTTGACAACTGGCAGGT
GCCGATGCCCTTCCTACATGGTTTCTTCTCCACTGGGACTGGGGAGATGGCTCCACGGTTAAAGGTGCTCGCTGCTCTTC
CAGAAGGAACAAGTTCAGTTCTCAGCACCCAAGGGAGGCTCACAACCCCCTGTAGTTCCAGCATCAGAGGGTCTCAAACC
CTCTTCCTGCCTCACCGGACATCCTCTCATGTGTTGCGTACATATACACGAACGTTACATATAAATAAAAAGCCTTAAAG
AAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45582826..45586499 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es