Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14187B1
Clone ID IST14187B1
Vector VICTR74
Project tigm

Sequence tag IST14187B1HMF1
Sequence
CACACACAAGGGAGGCAAGGCACTAGGAGGTGGCTTAATTTTATATATTAATATAAATATAATAGAATGTTAGGTAAGCA
GTCTATTCTATCCAGCCCAGCCCAGCCCCTGGACTTCTGATCCTCCTGCTTCCACCTCCAGAGTGCTAGGATTACAGGCT
TGTGCAACCACACCGAGTATATATGGTGCTGTAGCCCGAGCTTGGGGCCTCGGGCATCCCCAGCTCAAAGATCACTCTTG
GATTTTGGAGAAAATAAATTTTCTTCTACTTCCAAAGAAATTTGTTCAGACAACTCTACTTGTCCCGTGATGTTTACACA
TCTGTCTCCTTCACCATAATCCAGATTTGTGTTTTCAAAAATCCAGGTCCTACGCGCATGGCTTGTGTGATCAACACACA
CTTGTTGAGAAAAAAAATGAGTGAGTGAGTGAATGANTGANTGAANATGGAAGGTGGATATAGGTAANTGANCNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29400140..29400610 463
 
EST/CDNA Est Name
  CB181630.1 - BQ257026.1 - BY751682.1 - BQ257296.1 - CK793958.1 - CK795838.1 - CK794622.1 - CN683329.1 - BF135768.1 - BG970927.1 - CA978444.1 - CN671480.1 - DN173178.1 - BG863123.1 - BU516000.1 - CK620009.1 - CX216611.1 - BI078376.1 - CX731488.1 - AA930476


Sequence tag IST14187B1HMR1
Sequence
TGGCGGTCACAGTTGTTGTGGAAGCCTTACTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713907 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]

 
Come back to gene ENSMUSG00000074656


For any suggestions or comments, please send an email to unitrap@crg.es