Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S4-1E1
Clone ID FHCRC-GT-S4-1E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S4-1E1
Sequence
ACACCCCTTAATGATTAACATGCCCATGTGCAGACTAGAACGAGAATCTGAAGTTGTAAGACAAAGGAGACAAAGGAAAA
CAGAAGACGGGCACACCAAGCTCTATCCCGCTCTTGGCTGCCCATGGGGCCTCCAAGAGAAGGGTCAGCACTAATGAGCA
AAACCGGTCTCTCAACTCCTGCTGTGACATGGCTGCTCAGTGACTCCCAGACAAGAACCTCACCTGGGAAGATTGTCAGC
CTTTCCTCGGAGACGTTTAGTTCTTAGCTAACAAGTGGGATAGTGACCCTCACCCTTCCTGTCCCAGGCGGCTGTATAAC
AGGAGGGGTGGAATGGAAGAACCCTTGATACAAGTGTGGAGTCTAAGGTGCCACGGCTTACAGGCTGCAAGAGCTAGTAG
GCAAAAGGGACCCCCCGCTCAGCCGCCATGCTTCTCACCGTCATGCTGATGTTGGACGAAGCCCCTGAAGCTGTGAACAA
GCCCCCAATTAAATGTTTTGTAAGAGTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI8511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72243007..72243515 505
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es