Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11218C11
Clone ID IST11218C11
Vector VICTR76
Project tigm

Sequence tag IST11218C11HMF1
Sequence
CCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTTCAAGGCCAATCTGGTCTACAGAGTGAGTTCTAGGACAGCCA
GGGCTACACAGAGAAACACTGTCTCAACAAAACAAAACAAAAAAAGAACTTGAGTTACATACAGTTGTGAGCTGCCATGT
GGGTGCTGGAAATTGANCCCAAGTCCTCTGGAAAAAGCAGCCAGTGCTTTNAAACACTGANCNNTCTNNCTTTTTCCTTT
GGCCCCCTCCTNTTNTNCCCACACCCNATNATTGCCTGNCTGCCTNCACTTGNTNAAACCCTANTTTACAGTGGNTGTTN
TTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11218C11BBF1
Sequence
CCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTTCAAGGCCAATCTGGTCTACAGAGTGAGTTCTAGGACAGCCA
GGGCTACACAGAGAAACACTGTCTCAACAAAACAAAACAAAAAAAGAACTTGAGTTACATACAGTTGTGAGCTGCCATGT
GGGTGCTGGAAATTGAGCCCAAGTCCTCTGGAAAAAGCANCCAGTGCTTTTAAACACTGANCNNTCTCTCTTTTTCCTTT
GGCCCCCTCCTCTTCTCCCCACACCCCATCATTGCCTGGCTGCCTTCACTTGTTNAAACCCTAATTTACAGTGGTTGTTT
TTTNTN
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106582563..106582885 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es