Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10132C5
Clone ID IST10132C5
Vector VICTR76
Project tigm

Sequence tag IST10132C5HMF1
Sequence
GTCTCCTTTATATCCCCCGACCCCCAACCACCACTTTTGGTTTTTGAGACAGANGAGTGGAATATGATGGTTTATATATG
CTCAGCCCAGGAAGTGGCACTATTANGTCTACCCTGGTTGGAGAAGACGTGGCCTTGTTGGAGGTGTGTCCCTGTGACTG
TGGGCTTTAAGACCTTCATGTTGATAATCCTGCATTTTTCACAAAGCAAACCTACNNCATGTGATANATTAAAAAAAACA
AAACAAAACCCAAAGCCAGTANCACTGAATGAACACTACAAACTCTACAAAGCAATGGGCATCCCAAANACATTTTGTTC
CTTATACTTTATACNAGGGCTGGAAAATTCTCTAACTGTATACTGCGGGGCAGTTGCCCANGGGGAATAAAGGGAGTGGG
ACANNACATGGAGTCCTGCCAGANTTTCAGTGTTTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101493715..101494152 414
 
EST/CDNA Est Name
  BF122759.1 - BF161117.1 - CD771230.1 - CN672700.1 - BE303202.1 - CB566095.1 - CB236616.1 - CF616843.1 - CF158370.1 - CA537307.1 - CA548709.1 - BY738591.1 - BI697505.1 - BY094824.1 - BB632908.1 - DV055948.1 - BE374705.1 - BE860684.1 - CA556494.1 - AW744502


Sequence tag IST10132C5HMR1
Sequence
GAGACAATTATTTTGTGTGTATGCATGTACCACAGCCTGCTCTGAAGGTCAGAGAGTTC
Sequence Type genomic DNA
Unitrap ID UNI5870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101493662..101493719 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es