Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14391C11
Clone ID IST14391C11
Vector VICTR74
Project tigm

Sequence tag IST14391C11HMR1
Sequence
CTTATACTGTAANNAAGCTTACAGGCCAGGCAGGGGTACACTACAGGTGAGCCAGGCCCTGAANAACTGTATATAGTAGT
GAGCCATTCACAATAGGAGTTTACCGAACTGTCTGTGAATGGGTGTCACCTCCTTGCTATCTTAACTCAACAGTGCAATT
AACTCCTTAATCTTTCAAGAGCCACAAGGCATGTGCATCTTGACAACACACCTTGCATCCTTGTCCTGCANANGTCACTT
GCCNAGTAAGAGAACTTTGANGGAGTANAGTGGCANTTGCTAANAATAACTGCNNAN
Sequence Type genomic DNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50137418..50137710 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]


Sequence tag IST14391C11HMF1
Sequence
TAAGTACAACATGAGAATTGATTCTGTTCATGCCCTTTCAAAGGTTACTGGAAAATATACAAAGATTTTTAAGGTAACCC
AACTTGTCCCCCTTTAAAGGGGTGGGAGGGCAAATTATTTTTAAAAAACAGGCAGATTCTTCCATTTCTGAAGGGTAAAG
AGACTGTAGCTCAACTTTGCCAAGCTTTTAGTATTCAGTTTGGTTTAACTTCACACAACTAGCAATGCAATCACTAGTGT
CATGACCAGCAGTTAATACACAAAGTGTCATCNATGTGTCCTCAGGTCTTGGCACACAGGCCTTCAATATAAACATTANT
GTATCNNTGTAATGACCAANGCATTCNGATTTCNNNAANCCNNTTCNATTCCTACCCNCTGAACCTTTACNACACATNCA
ANTTCNNANTNNCATTCCCNNGNAANTCANTACAANGCCCATCNNTCNNTCNGTCNNCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es