Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14210A5
Clone ID IST14210A5
Vector VICTR74
Project tigm

Sequence tag IST14210A5HMF1
Sequence
CAGGGATGGAAGTGCCCAGGAGCAAGTTTGATGAGAGTAGCCGCAGGCGACACATCCATCTGTCGGGAAGCACGCCACCC
CAACCCCTTCCTTTCCGCCGCGGCTCCGCCCTCACCTGTCTGTCAGCGGGGAAGCCGGCAGCGCTCCGTCGCGGGCTCTC
CCGGTCGCAGCCCTCGGGAATCACGTCGGCCAGAGGGAGAAGGGACCGGAAGCGCAACCGGGAGCTTTTCCTTCGTCTCC
TCCCCCACGCCTCGGGGGCGGGGAGCANCTACAGCTGTCACAGGCTCCGGGCAACCAACCGCCNANGACACTTGCACCCG
CGACCTCTCAACCCGGTCTCCGGCGCTTGNACCCTACCCGCNAAGCCNGAAGCNANCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84386221..84386598 362
 
EST/CDNA Est Name
  NM_001081093.1


Sequence tag IST14210A5HMR1
Sequence
CCTGGGAGCAGCCNAGTCCGCCCCTTGGTCCCTCCTGTCCCTCTGAGTCTGAGTGTGTTCTGGAGTGAAGGGGGGCAGCA
CTGGCCCCTGGGGCGGCTCCGCTCGGCAGTGGGAAGAGTTGGCAGGGTCTGGGGCTTTCTGGACTCTGTCCGAGTGGGCC
GCCTTTCCCCCTGCTCTTCCCTGAGTGTCCTGCTTCCTCTCTCCTGCTGTGANAGGAAGGGAGGTAN
Sequence Type genomic DNA
Unitrap ID UNI16295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84385999..84386224 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074513 (Arfip1) NM_001081093 ADP-ribosylation factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277120]

 
Come back to gene ENSMUSG00000074513


For any suggestions or comments, please send an email to unitrap@crg.es