Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-9H1
Clone ID FHCRC-GT-S3-9H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-9H1
Sequence
CCGAGACCGCTGCTGCTTTGAACGTACAATAGAATCCCTGATGGACCGAGGAGCCATAGTGAGGAACTTGGAAAGCCTGG
GTGAGCGTGCGCTCCCCTACAGGATCTCGAGTCACAGCCAGCAGCACAGCCGAGGAGGGTATTTCCTGGTGGATTTTTAT
GCTCCGACAAGTGCTGTGGAGAACATACTGGAACACTTGGCGCGAGACATTGACGTGGTTAGACCAAATATTGTGAAACA
CCCTCTGACCCAGGAAGTAAAAGAGTGTGACGGCATAGTCCCAGTCCCACTTGAAGAAAAACTGTATTCAACAAAGAGGA
GGAAGAAGTGAGAAGATTCACCAGATTCTGGCCTTATATTTAATCCTAAGGGCACTATGGGTGCTGCTAGGTTGTTGTCT
AGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAACTGCTGGCCGAGACCTGCCCTGATGTCTCTGCTGAGA
TTTCATCCCACTTGTGGGGTTTGTCGGGAGTGGGGGTGTTCACAGTACCACTGTAGCGTTTCCAAGAGCAAAATGTTTGT
CATTCACACTTGGTTGTCTTGCAAGCCTATATGGAACACTGGGAGCAGAGTAATAAACATGACTTTATCAACAAAAAAAA
AA
Sequence Type genomic DNA
Unitrap ID UNI14644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 92099842..92112472 496
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039680 (Mrps6) NM_080456 mitochondrial ribosomal protein S6 Gene [Source:MGI (curated);Acc:Mrps6-001]

 
Come back to gene ENSMUSG00000039680


For any suggestions or comments, please send an email to unitrap@crg.es