Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14944B1
Clone ID IST14944B1
Vector VICTR76
Project tigm

Sequence tag IST14944B1HMF1
Sequence
CTAAGGATCCAGCAGAGCCTGGCTGAATCATCTCCAAGAAAAATTCACAGGAGAGGAGGTGAACCGGCCTTCAACTCAGC
CCCGGTTGAGGTGTGACTGTACAAAAACCCAGGGTCTCATATCCAAGTGCCCTAGTAAATCTATTTTTTAATAAGAAGGA
TTCACAGAGGATATCTGGTCTACCCCTTCCCCACTAGTCAGAGTCAATGACCTTGATTTCCAAATGAGCACGTGGACTTC
ANAGGCAAACTCCCAGGGTTTATGAAAACAGACTTTAAATTGCTTCCACATCTGGAAACCAAANCGGCAGCTAGCCCCAA
GAATTCCANGCNTGCCAGCCACGGANAAGCANANGGTNNNNGGAGGCNNTTCCTGTTNNCCTGANGTTCCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14944B1HMR1
Sequence
TTATTGCCNTCCCTGTACTGAACAGCTGTGGGGGCAGGGGATAAAGGCCCTCAGGAGGCTGGCATCACCGCTGAGCTGGG
TGCCCACGTGGCCCCCCGAGTGGTAGAGGCCCTTTTTCCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI20684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79484029..79484149 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es