Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-6G1
Clone ID FHCRC-GT-S3-6G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-6G1
Sequence
ATTTTGTATTTTGTACATACATTTTGTATATTCTGTATATGATGACTTCTGTGAGCAATGATCGTTGCCGAGGTGCTCGG
GAAAAACCACAGATGCCAACAGCACACGCAGCCCAGTCACAGAAACAAGTGGTGCAGGCAACAGCTGAGCAGATGCGGCT
TGCTCAAGTGATCTTTGATAAGAATGATTCAGATTTTGAAGCTAAAGTTAAGCAGCTTATGGAAGTGACGGGAAAAAATC
AGGATGAATGCATCGTGGCCCTACATGACTGTAATGGTGATGTGAACAAAGCTATCAATATACTGTTGGAAGGGAATTCT
GACACCACTTCATGGGAGACTGTAGGAGGGAAGAAGAAGAATTTTGGAAGAGAAAGTTCAGAAAACAAAGAAAACAGAGA
GAAGAGGACGGAGAGAGAAGCGAGTCGTGGACGGGGAACCAACAACCGCAAGGGAAGAGGCGGCAACCGAGTCCGAGAGT
TCAAAGGTGAAGAGAATGGGATTGACTGCAGCCAAGGAGACAAGCCTGCGGAGCGGGGCAAGCGGGCCCGAGGCAGAGGA
TTTGGACGTGGCAGGGGCAGAGGGACAGGAAGGTTCTCCGCTCAAAGCATGGGGACATTCAATCCTGCAGACTATTCAGA
GTCCATGTCTACAGATGGCTGTGGGACAAAGTTGGCAGTTTGGGAAGCTGCTCAGAATGGTACAGATGAGGGACCGGGAT
TGTG
Sequence Type genomic DNA
Unitrap ID UNI4705

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41170388..41198704 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es