Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-6F1
Clone ID FHCRC-GT-S3-6F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-6F1
Sequence
GGCGAGTCTGGACTACAGGAGAAGTGTGCAGCAGCTGGGTCCGGTGTGTGAGGCCATCCACCTACACATCTCAGCTCTGA
CCAGGGCTCAGTTTGAAATTCAGTATTCGCCTTGGTACCAGTGGACAACTTATCCAGAGTTGTTTCTTGAGATACTTGAT
GCCTTGCAAAGCTCGCAGCCTGCTGCCGTCTCCCTCGGCGTGATGAAACTAGCTTCCTGTCTGGAGCGAGCCCTCGGCGA
CGTATTTTTACTGGTTGGGAAAGAGTGCCCCTTTCTCCTAAGAGATCTTCTTGCATCTGCAGAGCTTGCACAAGTCTTTG
GACATGCTGTGA
Sequence Type genomic DNA
Unitrap ID UNI14648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15117222..15119353 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es