Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10198H3
Clone ID IST10198H3
Vector VICTR76
Project tigm

Sequence tag IST10198H3HMF1
Sequence
GTGCCTTCATGATCAAAATTCGATAGTCAATAGTACTAGAAGAATCATATGTCTGAAAATCCTTCCTTCCTTCCTTCCTT
CCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTNTTTNTTTCTTTNTNCCTTTNTTTNTTTNTTTNTT
TNTTTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10198H3BBF1
Sequence
GTGCCTTCATGATCAAAATTCNATAGTCAATAGTACTAGAAGAATCATATGTCTGAAAATCCTTCCTTCCTTCCTTCCTT
CCTTCCTTCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCCCTTTCTTTCTTTCTTTCTT
TCTTTCT
Sequence Type genomic DNA
Unitrap ID UNI30913

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12302965..13240410 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047678 (Gpr82) NM_175669 G protein-coupled receptor 82 Gene [Source:MGI (curated);Acc:Gpr82-001]

 
Come back to gene ENSMUSG00000047678


For any suggestions or comments, please send an email to unitrap@crg.es