Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14149C6
Clone ID IST14149C6
Vector VICTR74
Project tigm

Sequence tag IST14149C6BBF1
Sequence
AATGTAACAGTGCCTTTTATGGTTTATATTTNAGATTTTACCNGGGGNTTCCATGACCNCATGCCTTTCTCCTTTAGTGC
ATGACTTGATTTGTAACCTTGGGTTTGAACTCAAAGAAATTTGTGATATCAATAGCATTGTAACTCAAAATGGTGAAGTA
CNATGGAAAGCAATTACTGACCGTGTGAGANATGAAGAATTANGTTTGTATTCTCTTTGTACATCAAGCTTCCGTTAGTA
CTGTNNCATTAAAAATTTGTTGTGTGGTTAAACCTTCATTTGTTCTTCTTGAAGAGTGTTATAGTGTGGTTGTAAATCAG
AGGANAAATATTCNAAAGTCNNGN
Sequence Type genomic DNA
Unitrap ID UNI14648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116431..15116770 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]


Sequence tag IST14149C6HMR1
Sequence
ATTCNAGTGGAAAGAAAATCCGACCTTAAGAACAGAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116396..15116433 36
NO GENE  

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es