Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-4F1
Clone ID FHCRC-GT-S3-4F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-4F1
Sequence
GGCCTGGAAGTCGGTCTTCACTAGCAGCCTCTGGATGAAGACGTAGAACTCTCAGCTCTGCCTGTGCCATGCCTGCCTGG
ATGCTGCCCTGCTCCCACCTTGATGATGATGGACTGAACCTCTGAACCTGTCAACCCTTTCAGAGACCGCATCTGCAGGG
TATTCTCCCACGACAACGTGTTCTCCTTTGAAGACGTGCTGGGCATGGCATCTGTATTCAGTGAGCAGGCCTGCCCCAGC
CTGAAGATTGAGTATGCCTTTCGTATCTATGATTTTAACGAGAATGGTTTCATTGATGAGGAGGACCTCGAGGAGATTGT
GCTAAGACTACTGAAAAGTGACGACGCGTCTGAGGACCTGCTGATGGACGTCATGCACCATGTCCTGAGTGAGTCAGATC
TGGACAATGACAGTATGCTTTCCTTCTCCGAGTTCGAACACGCCATGGCCAAATCTCCAGATTTCATGAACTCTTTTCGG
ATTCACTTCTGGGGCTGCTGATGTGGAGGTCATCGGCTGGTTCGGCAGCTTCAATGAAGACTACTGGACACCCCCTGCAT
CCAGGCACTGTAGAATCTGATTTGAATTATGACTCAGCTCTGTCCATCCTTCACCTCTAGAGTACTGTTTGCTAAGTAAA
TATGTGTTTCCCCC
Sequence Type genomic DNA
Unitrap ID UNI14650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30787957..30808926 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053194 (Cib4) calcium and integrin binding family member 4 Gene [Source:MGI (curated);Acc:Cib4-001]

 
Come back to gene ENSMUSG00000053194


For any suggestions or comments, please send an email to unitrap@crg.es