Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-4D1
Clone ID FHCRC-GT-S3-4D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-4D1
Sequence
ATTCGATATCGCAAGGACCGTGCCATTGCCCGAAGGGCTCCCTGCTTTCCGAATGTGACTACCCTTCAGGACCTGGCCAG
TGGGGCAGCACTGGCTGCCACCATCCACTGCTATTGTCCCCAGCTATTACGACTTGAGGAGGTGTGCCTCAAGGACCCCA
TGTCTGTGGCAGACAGTCTATACAACCTCCAGCTGGTGCAAGACTTCTGTGCCTCCCATCTTCCTCGAGGCTGCCCCCTG
TCCCTTGTCTGTCCTCCACTTTCTTGAATAAAATAACTGAAAAGAGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3600676..3602073 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044433 (2310057J16Rik) NM_027171 RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]

 
Come back to gene ENSMUSG00000044433


For any suggestions or comments, please send an email to unitrap@crg.es