Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14137B10
Clone ID IST14137B10
Vector VICTR74
Project tigm

Sequence tag IST14137B10HMF2
Sequence
ATGAAGGTATGGGTCAATCCTCCAGGAAAAGAGCCAAGACCTGCTGAGGTGCTGGCTGAAGGTGAANGAAATACAGAATG
GGTAGTAGAGGAAGGTAGTTATAAATACCAATTAAGGCCACGTAACCAGTTGCAGAAACGAGGATTATAAAGTAATATGA
ATGCCCATTGTAAATTTACTANTGCNTTTGCGATTGTACGAGGGATAGTTATATCATGTTAGGCGTATTTACAACCNNNN
NNNNNNNNNNNNNNNACATGAGATATTATTTGTGTCAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 72726..73006 230
NO GENE  


Sequence tag IST14137B10HMR1
Sequence
ATTCCTGATGGGTCTGCGTCCTTTGTCATCCTGCTTGGATTAGGCTGTTGTAGTTTCCCATTGACTTTAATCACAGGACA
TGGTAGTACTAAGAGACGCCCTAAGGGATCTCCTGCACTCCAGACATAATCTTGCTTACCACCATTGTGAAGAGGTAATC
CAATTTCCCCATGGTAATCTGGATCTATCACCCCTCCTANCACTGTTATTCCTTTTTTAGCCTGTTGGTTTAAGGGCATT
ANAAGCCCAAAATGACCAGGGGGAAGTCTGANCTTCCNNTTCAATGAAATGTTTGTTGTANCTCCTGGTAGGANCACTCC
CCTCTCTGGAGCCAAAANTTCNNNGCN
Sequence Type genomic DNA
Unitrap ID UNI9273 UNI30944 UNI30945 UNI30946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17093121..17093461 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054366 (Prune2) prune homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1925004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4658835..4659175 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033960 (9430020K01Rik) NM_001081963 RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37576606..37576946 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819636..31819976 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16879325..16879665 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 106500177..106500517 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9511133..9511473 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22296211..22296551 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20424417..20424757 325
 
EST/CDNA Est Name
  BU563801.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14976900..14977240 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10938990..10939330 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7260755..7261095 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 11071206..11071546 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19349796..19350136 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32977558..32977898 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39595290..39595630 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30463763..30464103 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17871239..17871579 325
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3850795..3851135 325
 
EST/CDNA Est Name
  AI930322.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 13198400..13198740 325
 
EST/CDNA Est Name
  CK390474.1 - CJ099434.1


Sequence tag IST14137B10BBF1
Sequence
GAATGAAGGTATGGGTCAATCCTCCAGGAAAAGAGCCAAGACCTGCTGNNGNNNTGGCTGAAGGTGAAGGAAATACAGAA
TGGGTAGTAGAGGAAGGTAGTTATAAATACCAATTAAGGCCACGTAACCAGTTGCAGAAACGAGGATTATAAAGTAATAT
GAATGCCCATTGTAAATTTACTAATGCGTTTGCGATTGTACGAGGGATAGTTATATCATGTTAGGCGTATTTACAACCTT
GTTATTGTTTCATGTGAACATGAGATATTATTTGTGTCAAGTTGACAAGGGGTGGATTGTAGTGGCTATTCCTGGTTGTC
AACTTGACAATATTTGGAATGAACTACAATTCGGAATTGGAAGGCTCACCAGTGACCCTTATCTGGAGGCTTGGAGATCC
TTATCTGGATCTTGGTTTGAANANCTG
Sequence Type genomic DNA
Unitrap ID UNI35179

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54952268..54952693 412
 
EST/CDNA Est Name
  BE985774.1 - CJ108887.1 - CJ124914.1 - CJ107361.1 - CJ070628.1 - BY015027.1 - BY183611.1 - AA105804.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 104432745..104433170 412
 
EST/CDNA Est Name
  BG085026.1 - AA466942.1 - AA547653.1 - AA794643.1 - AA422880.1 - AA683706.1 - CJ084515.1 - AA824094.1 - AA656625.1 - AA549323.1 - AA794661.1 - AA536957.1 - AA693070.1 - AA793675.1 - AA415307.1 - AA547508.1 - AA549455.1 - AA681738.1 - AA617278.1 - AA413487
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45468307..45468732 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 46557500..46557925 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62186117..62186542 412
 
EST/CDNA Est Name
  BG073289.2 - AW549019.2 - CN838362.1 - CN837148.1 - BU962012.1 - DV052054.1 - BU560964.1 - BU525855.1 - CK372584.1 - CK385034.1 - BU604036.1 - CB593842.1 - BU562370.1 - BU524470.1 - BU848439.1 - CB599373.1 - BU525796.1 - BI991169.1 - BI987389.1 - BI987430
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 106365538..106365963 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16878903..16879328 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13093417..13093842 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53892686..53893111 412
 
EST/CDNA Est Name
  BU583481.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53998719..53999144 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 62170813..62171238 412
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036885 (AC114424.10) NM_001081295  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34465721..34466146 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69759900..69760325 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 59737936..59738361 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11415759..11416184 412
 
EST/CDNA Est Name
  CN690672.1 - CA533825.1 - CF893427.1 - CN678574.1 - AA546950.1 - AI505898.1 - CJ073297.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45000150..45000575 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 49895707..49896132 412
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3269983..3270408 412
NO GENE  

 
Come back to gene CN690672.1 - CA533825.1 - CF893427.1 - CN678574.1 - AA546950.1 - AI505898.1 - CJ073297.1


For any suggestions or comments, please send an email to unitrap@crg.es