Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-3B1
Clone ID FHCRC-GT-S3-3B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-3B1
Sequence
CATAAAGAACAACATTCCTTTGAGCTAGAAGAGAGAGCCTTGGCCAGCGTCCTCCTCCAAGACCATATCCGAGATCTTGA
TGTGGTGGTAGTATCAGTGGCTGGTGCTTTTCGAAAGGGTAAATCCTTCATTCTGGACTTTATGCTGCGATACTTATATT
CTCAGAAGGAA
Sequence Type genomic DNA
Unitrap ID UNI6430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7583888..7584052 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024759 (5730596K20Rik) NM_146091 atlastin GTPase 3 Gene [Source:MGI Symbol;Acc:MGI:1924270]

 
Come back to gene ENSMUSG00000024759


For any suggestions or comments, please send an email to unitrap@crg.es