Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12171C12
Clone ID IST12171C12
Vector VICTR76
Project tigm

Sequence tag IST12171C12HMR2
Sequence
GATNNTTAACTGACCNGTATCCATGGTTAATAAACAGTACGGAGCTTGAAGCANTGTGACTTGCTGCCTATTTGTGAACC
CTCTGTTGAGGGGAAGGTTTCTGCATCCTTGTCCTTGATTTGACTGATTTCCTTTGACTTTTTGATTAGGGAGGATAATT
GTATTATTTCTGACTTTACTTTAACATTATTATGTCCTCCTAATTATGAAAATAATATACTTAGTTTTTGTTGTATANAG
ACAGGATCTCATGTATCCCAATATGGTGGTTTGAATAGGTTTGGTTCCCATAGATTCATGTGTTTNNATGCTTGN
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13991736..13992049 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]


Sequence tag IST12171C12BBR1
Sequence
CTATGGTNACCAATATGGTGCACAGACATACATACAGGCCAAAAACCTCATGGCCATGGGGGGAAAAGTGTTAGTTGGTT
TCACCTGTGTCAGCATACCCTGGCCACAAACATATAATCTTGTCTGTCAGCACATGGAGTCAGAGTGAAGGTGTAAGACT
CTGGGGAGCTTTAGCTTACCGGGGACACCCCCCCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78220088..78220285 196
NO GENE  


Sequence tag IST12171C12BBF1
Sequence
CCTGTANAGCTTACATTAAGGAAAATCANCATCACTGCCCACCGCCCTGACCGTGCCTATCACCAAGGTCGCTCACATTA
TTTTCCTATTGTGCTTTCAGTACAGATGACGCATGCTCCAGTAAGAAAAAACAAGTTTCGCACCGGGCGTGGTGGCGCAC
GCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCN
AGGACAGCCAGAGCTATACAGAGAAACCCTGCCTCGGAAAACCNAAAAAAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 133201290..133201600 301
 
EST/CDNA Est Name
  BY223169.1 - BY183460.1 - AA624267.1 - AI594322.1

 
Come back to gene BY223169.1 - BY183460.1 - AA624267.1 - AI594322.1


For any suggestions or comments, please send an email to unitrap@crg.es