Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-12C1
Clone ID FHCRC-GT-S3-12C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-12C1
Sequence
ATCAAAACAAGAGGATTTAGAGATGGACGCTTTGTTGGAAGGAATACAAAATCGGGGGCATAGTGGGGGATTTTTGACAT
CCTGTGAAGCAGAACTGCAAGAGCTCATGAAACAGATCGATATAATGGTGGCTCATAAGAAGTCGGAGTGGGAGGGGCAG
ACGCACGCTCTGGAGACTTGCTTGGACATCCGTGATCGGGAGCTGAAGGCTCTGAGGAGTCAGCTGGACATGAAGCACAA
AGAGGTTGGAATATTGCATCAGCAGATAGAAGAACATGAGAAATTCAACACCTGAACAGTAAGCTTGAGCGGGCTAAGGA
CACCATCTGTGCCAATGAGCTGGAAATAGAGCGCCTTAACATAAGGGTCAACGACCTGATGGGAACCAATATGACTATCC
TGCAGGACCATCGGCAGAAGGAGGAGAAACTAAGGGAATCTGAGAAGTTACTAGAGGCTCTGCAGGAAGAACAGAAAGAG
TTGAAGGCAAGTCTTCAATCTCAAGAAACCTTCATCCTTGAGGCAAAAATGCAGGAGAAACTGCAAACGACATTAAAGGC
AGTTGGCACTCAGCAGTCCGTAGAAAGGCCTCTGGAGGACTGTCAGAAGGAAAGGAAGTACAGCTCTCCAGGGCAAGGAG
TCTTGGATAATGTGCTCTCCCAGCTGGACTTCAGCCACAGCAGTGAAGAACTCCTGCAGGCAGAGGTGACGCGTCTTGAA
Sequence Type genomic DNA
Unitrap ID UNI14654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102503652..102522086 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032534 (AL450317.13) NM_001081122 centrosomal protein 63 [Source:RefSeq peptide;Acc:NP_001074591]

 
Come back to gene ENSMUSG00000032534


For any suggestions or comments, please send an email to unitrap@crg.es