Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10945A5
Clone ID IST10945A5
Vector VICTR76
Project tigm

Sequence tag IST10945A5BBF1
Sequence
GGTGCATGCTTTCAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGT
GAGTTCCAGAACAGCAAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAAAAAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121259146..121259291 146
NO GENE  


Sequence tag IST10945A5HMR1
Sequence
CACCACTANGTNNANAGTTTTCTGCCNTTTTATTTATTAACATATCTCATTCTGCTTCTTAGTATCTTAATTTGGTAGTA
ACATGCAGAATTTAATTTTTTCATGTATCTTCTACCTGGCTATTGTTCACGGACATTAAAGGACCTTGCCATCTGTGCTA
CTTTGTTTTATCTCTGTGTTTCCANGTCCGTGGTTGTATCTGTGGATTGTTACTACTACTACTTCCTCCTCCTTCTCCTC
TTCTTCTTCTGTCTTGTTTTTCGTTTCTTGANACATGTTTTCATGTANCCCAAGCTGGCCCCTGCTCTTTN
Sequence Type genomic DNA
Unitrap ID UNI14300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121259288..121259597 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032536 (Trak1) NM_175114 trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]


Sequence tag IST10945A5HMF1
Sequence
GGTGCATGCTTTCAATCCCAGCACTTGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAGAGT
GAGTTCCAGAACAGCAAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCAAAAAAAAAAAAAAAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121259147..121259291 145
NO GENE  

 
Come back to gene ENSMUSG00000032536


For any suggestions or comments, please send an email to unitrap@crg.es