Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11018A4
Clone ID IST11018A4
Vector VICTR76
Project tigm

Sequence tag IST11018A4HMF1
Sequence
ATTGTAATAAGAAAGAAAGAAAGAAAGAAAGAAAGAG

Sequence Type genomic DNA
Unitrap ID UNI30004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 103822935..103822970 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034751 (Mast4) microtubule associated serine/threonine kinase family member 4 Gene [Source:MGI Symbol;Acc:MGI:1918885]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3351151..3351186 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3006006..3006041 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181667159..181667194 34
NO GENE  

 
Come back to gene ENSMUSG00000034751


For any suggestions or comments, please send an email to unitrap@crg.es