Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-11B1
Clone ID FHCRC-GT-S3-11B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-11B1
Sequence
ATAGGAGGTCGGCCAGTTCCTCCTGCCTTCTGGAAGATGGTTCCCAGACTGCCCTTTGAGAATAAAATGGGAGGCCACAA
CCAAAGTCTTTTGGATAAAGCACCACAATGGACAATGTAAGGAAGGCAGCCAAACGCTTACGCTTCCCAAGGCACAGATC
TTTCCCAGCATGGGGAAAGATCCTCCCTCCCTCCCTCCCTCCCTCCCTCCTTCCACCATACACTCAATAAAATAAAAAAA
AAA
Sequence Type genomic DNA
Unitrap ID UNI14655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42497149..42497470 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032017 (Grik4) NM_175481 glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI (curated);Acc:Grik4-001]

 
Come back to gene ENSMUSG00000032017


For any suggestions or comments, please send an email to unitrap@crg.es