Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S3-10F1
Clone ID FHCRC-GT-S3-10F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S3-10F1
Sequence
GTATATGTCATTAGTGTGGACGCTGCTGTCTTAAGTCTGTGGCCATGGCACCAGAACACAGTAAGTAGCAATGTTGCAAA
CTTTGGCTTTCTGGGTTTGAATATCTTCCTGGGGATGGAGCCCCCAGATGCATTCAGGCAAATGGACATTCACTTAGTTA
AACCCCAATATGTATGTTTTGAGTTTCTAATTGCAGAGAAAGAAATATAAAACCAAGAAAAACAACTTAGTTTCCTCTTT
TCACAGGGCATTCACTTTATTTCCTGGGGTTTAATTTTTTTACTTTCACATACAAAAACATGGTGATAGTCATGACCTGC
ATGTTCCTGTACACCCAGTGTTTGCCTGTAGTGGCCAGCAGAATGGGCAGCATGGCTGAACTGTGTCACTTATGCTGTCT
ATTCTTTGTGTTCGGGATCAGGGAGGCTGAGCACAGCTGAAGGGTGGACCTGCTGAGCTGTGGTCTCAAGCTGCCTGTCC
ACAACTGGCTTGCCAACTTTGGCTCCTTCATCAACTCTGAGGCAATGCCTAGCCAGGGGGATGGTCTCAGAAACAGCCCT
AGTTCTAGATCTAGTTCTAGTTCTAGTTCTAGCTCTAGCTCGTGAGACTCTGGGTGGGAGACCCTGTGGCAGGATTGCAC
CAAGAGACCCCAGTGGGTGACTCTGCAGCTCGAGACCCTGAGGCAGGTGTACCTAATCTTCTGGCGGAAGTCACCTCATA
Sequence Type genomic DNA
Unitrap ID UNI14266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83412339..83413056 716
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es